ganglioside-induced differentiation-associated protein 1 (GDAP1) - coding DNA reference sequence

(used for mutation description)

(last modified April 8, 2011)


This file was created to facilitate the description of sequence variants in the GDAP1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008787.1, covering GDAP1 transcript NM_018972.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5019
                                          gaaacgccttgcggggcag       c.-61

 .         .         .         .         .         .                g.5079
 tgtgggagggagaagtccagggcggacaggctgggcgcacccgtgctcgcgcaccccaag       c.-1

          .         .         .         .         .         .       g.5139
 ATGGCTGAGAGGCAGGAAGAGCAGAGAGGGAGCCCGCCCTTGAGGGCGGAAGGCAAGGCC       c.60
 M  A  E  R  Q  E  E  Q  R  G  S  P  P  L  R  A  E  G  K  A         p.20

          .         .         .         .         .        | 02.    g.5894
 GACGCGGAGGTTAAGCTCATTCTGTACCATTGGACGCATTCCTTCAGCTCTCAAAAG | GTG    c.120
 D  A  E  V  K  L  I  L  Y  H  W  T  H  S  F  S  S  Q  K   | V      p.40

          .         .         .         .         .         .       g.5954
 CGCTTGGTAATTGCTGAAAAGGCATTGAAGTGCGAGGAACATGATGTAAGTCTGCCCTTG       c.180
 R  L  V  I  A  E  K  A  L  K  C  E  E  H  D  V  S  L  P  L         p.60

          .         .         .         .         .         .       g.6014
 AGTGAGCACAATGAGCCTTGGTTTATGCGTTTGAACTCAACTGGAGAAGTGCCTGTCCTT       c.240
 S  E  H  N  E  P  W  F  M  R  L  N  S  T  G  E  V  P  V  L         p.80

          .         .         .         .         .         .       g.6074
 ATCCACGGGGAAAACATAATTTGTGAGGCCACTCAGATCATTGATTATCTTGAACAGACT       c.300
 I  H  G  E  N  I  I  C  E  A  T  Q  I  I  D  Y  L  E  Q  T         p.100

          . | 03       .         .         .         .         .    g.14804
 TTCCTGGATG | AAAGAACACCCAGGTTAATGCCTGATAAAGAAAGCATGTATTACCCACGG    c.360
 F  L  D  E |   R  T  P  R  L  M  P  D  K  E  S  M  Y  Y  P  R      p.120

          .         .         .         .         .         .       g.14864
 GTACAACATTACCGAGAGCTGCTTGACTCCTTGCCAATGGATGCCTATACACATGGCTGC       c.420
 V  Q  H  Y  R  E  L  L  D  S  L  P  M  D  A  Y  T  H  G  C         p.140

          .         .         .         .         .         .       g.14924
 ATTTTACATCCTGAGTTAACTGTGGACTCCATGATCCCGGCTTATGCAACTACAAGGATT       c.480
 I  L  H  P  E  L  T  V  D  S  M  I  P  A  Y  A  T  T  R  I         p.160

      | 04   .         .         .         .         .         .    g.16557
 CGTA | GCCAAATTGGAAACACAGAGTCTGAGCTGAAGAAACTTGCTGAAGAAAACCCAGAT    c.540
 R  S |   Q  I  G  N  T  E  S  E  L  K  K  L  A  E  E  N  P  D      p.180

          .         .         .          | 05        .         .    g.17577
 TTACAAGAAGCATACATTGCAAAACAGAAACGACTTAAA | TCAAAGCTGCTTGATCATGAC    c.600
 L  Q  E  A  Y  I  A  K  Q  K  R  L  K   | S  K  L  L  D  H  D      p.200

          .         .         .         .         .         .       g.17637
 AATGTCAAGTATTTGAAGAAAATTCTTGATGAGTTGGAGAAAGTCTTGGATCAGGTTGAA       c.660
 N  V  K  Y  L  K  K  I  L  D  E  L  E  K  V  L  D  Q  V  E         p.220

          .         .         .     | 06   .         .         .    g.18628
 ACTGAATTGCAAAGAAGAAATGAAGAAACCCCAG | AAGAGGGCCAGCAACCTTGGCTCTGC    c.720
 T  E  L  Q  R  R  N  E  E  T  P  E |   E  G  Q  Q  P  W  L  C      p.240

          .         .         .         .         .         .       g.18688
 GGTGAATCCTTCACCCTGGCAGACGTCTCACTCGCTGTCACATTGCATCGACTGAAGTTC       c.780
 G  E  S  F  T  L  A  D  V  S  L  A  V  T  L  H  R  L  K  F         p.260

          .         .         .         .         .         .       g.18748
 CTGGGGTTTGCAAGGAGAAACTGGGGAAACGGAAAGCGACCAAACTTGGAAACCTATTAC       c.840
 L  G  F  A  R  R  N  W  G  N  G  K  R  P  N  L  E  T  Y  Y         p.280

          .         .         .         .         .         .       g.18808
 GAGCGTGTCTTGAAGAGAAAAACATTTAACAAGGTTTTAGGACATGTCAACAATATATTA       c.900
 E  R  V  L  K  R  K  T  F  N  K  V  L  G  H  V  N  N  I  L         p.300

          .         .         .         .         .         .       g.18868
 ATCTCTGCAGTGCTGCCAACAGCATTCCGGGTGGCCAAGAAAAGGGCCCCAAAAGTTCTT       c.960
 I  S  A  V  L  P  T  A  F  R  V  A  K  K  R  A  P  K  V  L         p.320

          .         .         .         .         .         .       g.18928
 GGCACGACCCTTGTGGTTGGTTTGCTTGCAGGAGTGGGATATTTTGCTTTTATGCTTTTC       c.1020
 G  T  T  L  V  V  G  L  L  A  G  V  G  Y  F  A  F  M  L  F         p.340

          .         .         .         .         .                 g.18985
 AGAAAGAGGCTTGGCAGCATGATATTAGCATTTAGACCCAGACCAAATTATTTCTAG          c.1077
 R  K  R  L  G  S  M  I  L  A  F  R  P  R  P  N  Y  F  X            p.358

          .         .         .         .         .         .       g.19045
 gtttgttgggatcttgtcgtggcagctcatccaagcatttagctagaccctgtgattgcc       c.*60

          .         .         .         .         .         .       g.19105
 cgtggctctctgagtctgtcttattgagtagttagcagtattttttcctaaaattcagaa       c.*120

          .         .         .         .         .         .       g.19165
 gtcatctttgttacacaacacaggggttcaggtagcaataggacacaaaattgctttatt       c.*180

          .         .         .         .         .         .       g.19225
 ctacaactgccagctccaggcagaaataggaaggcaaagagataagagaaggaaaaatga       c.*240

          .         .         .         .         .         .       g.19285
 gagaatgaagtctgtatagggtagagcaatagaaagtaagcttcgggtgcctccaacgtt       c.*300

          .         .         .         .         .         .       g.19345
 catggctgcctgtctcattggtaaacctcacatttagttacttgtggctactgcccacac       c.*360

          .         .         .         .         .         .       g.19405
 atacacttctgtaattgagaactcttaggagaggactagggaatcactggggatagtggg       c.*420

          .         .         .         .         .         .       g.19465
 ctggagagaaccccaggctttatatgtatactttgacctcagtgttaattttaaatgctt       c.*480

          .         .         .         .         .         .       g.19525
 atgaatcacacacattgctttagtaagattaagtgcttatatactagaaatttgatgctc       c.*540

          .         .         .         .         .         .       g.19585
 attggaacacatctgcctagcatttctgtaaaagtcttaagtgatattaagatgattcct       c.*600

          .         .         .         .         .         .       g.19645
 taccatttcagatggtccgcaatttgaattaccaagtggtaatggttccttactgtttta       c.*660

          .         .         .         .         .         .       g.19705
 gatggtgcctgtgagataccattcctctggatggtcatgtccagtcagtgggaggtagaa       c.*720

          .         .         .         .         .         .       g.19765
 agggtggcatctgtagccctcttcatacacataagtggcatttaggtgaatgtcccagct       c.*780

          .         .         .         .         .         .       g.19825
 aatcactagcatgtctaggtattggctgggtagtgggtattttgatgatctgggagcacc       c.*840

          .         .         .         .         .         .       g.19885
 aaatatgttcattcttcgtttggggaggctggtctgtaaacacaaaaattgttgtccaga       c.*900

          .         .         .         .         .         .       g.19945
 tctttcatctgtttatgatcatcaacaaagacttgttagaaaggtctagtcttagcactt       c.*960

          .         .         .         .         .         .       g.20005
 ggcagttaatctagggaagatgaattaaatgggtagatagtgatgcatacctgtattcac       c.*1020

          .         .         .         .         .         .       g.20065
 tgatgtatgtttaagggatttgggggggatacctcagttcatgtggaagggacagtctcg       c.*1080

          .         .         .         .         .         .       g.20125
 gtgtgtcccatgaataaccttggaactgcaacaaatggtttgtgctcagaaaaagtcttt       c.*1140

          .         .         .         .         .         .       g.20185
 catggtgacaggaagacagtttccctggagctggccatgaaggccttagaagccatttct       c.*1200

          .         .         .         .         .         .       g.20245
 ggtgtctggtgggtagcaggcatagagatgatgtgccgaggtcccagtgaacaacagtag       c.*1260

          .         .         .         .         .         .       g.20305
 ccaaagaatgtactaactttatcattaataggaaagtcatacctaggaaacaatgacttt       c.*1320

          .         .         .         .         .         .       g.20365
 ttgatggcaaaatgattttttaattctattttgatgctgtaattccatttcatgacctag       c.*1380

          .         .         .         .         .         .       g.20425
 ttgtattagaaaaccttgatgaactatatgttcccgatttacaaaaaaattaataaaacc       c.*1440

          .         .         .         .         .         .       g.20485
 tccagagtaaactcagtcaaacaataattgagtagcagcttttataacatttaaaatttg       c.*1500

          .         .         .         .         .         .       g.20545
 cacatgagtgtgttgtcatatggagtgtctgaatctgttgctgggacataccaatccatg       c.*1560

          .         .         .         .         .         .       g.20605
 tattcattagagccatagaagttattattcattagttcatagtgtttgagttctttatgt       c.*1620

          .         .         .         .         .         .       g.20665
 cactctgttagaaacaagaactgagtcgtgaagaaataagaattggatttttataaaaac       c.*1680

          .         .         .         .         .         .       g.20725
 ctctgaaggatatttacctatgaaaaagttgttaagaataaaaattagaagtccatggtt       c.*1740

          .         .         .         .         .         .       g.20785
 aacttttccttcaatttatattattcctgaatcatagggaatctttctagaatgtgttta       c.*1800

          .         .         .         .         .         .       g.20845
 taatttccttgtacagtttctttggaaatacgttaaagatagtggcaatttcatatattt       c.*1860

          .         .         .         .         .         .       g.20905
 catggatacttgagtttgtgcttttaaggtgtttgtttagggatacaatgaccactagat       c.*1920

          .         .         .         .         .         .       g.20965
 gtcgctgtttatccagtagactaagattgagtgttctttttgttcagcaactcttctaaa       c.*1980

          .         .         .         .         .         .       g.21025
 atgtttcaagcaaagatagtaatgacctcagtttctgaaataagggcatcttcatcagat       c.*2040

          .         .         .         .         .         .       g.21085
 tattcttctgttttaaaaaaaagcttgaggcaaatgtgagtgatttccagtgctttgaaa       c.*2100

          .         .         .         .         .         .       g.21145
 gggattacagtatcacacaatgtcaagctagagttaaacacagtattagctaaataggca       c.*2160

          .         .         .         .         .         .       g.21205
 cttatgtgtattttctttttcatgattatcggtgactggtcagtgtactcatcaatttcc       c.*2220

          .         .         .         .         .         .       g.21265
 aaaatttgtataaatatcacaattagaaaaatgcctgaggtactaaagttatgttggctt       c.*2280

          .         .         .         .         .         .       g.21325
 tttgtgtcttaacacacataaatactattgttattgcagcagatgccttttgaatccatt       c.*2340

          .         .         .         .         .         .       g.21385
 ttccataattgcggatagtcataaattgcttgctcaatttttagtaattattgctgttga       c.*2400

          .         .         .         .         .         .       g.21445
 caccagcgttgtagatttttggtgttgttgaatgcagtagagagaccaagacactattct       c.*2460

          .         .         .         .         .         .       g.21505
 gtaagatcaataaaagtaattggaaaataaatatgaaccctaaaacaaagtactcacttt       c.*2520

          .         .         .         .         .         .       g.21565
 gtaatcttttttggaaaacagatatatttttttcatttaaaatcaaagcatcatgtggta       c.*2580

          .         .         .         .         .         .       g.21625
 gttaaaagggtaaaataagcagaggttaggtattcaagatacttagctataggatgccat       c.*2640

          .         .         .         .         .         .       g.21685
 attttcgttataacaaaattgctgactcttgcttcatttaaatatgcacggttaaaatga       c.*2700

          .         .         .         .                           g.21728
 atagcggcctaaagaataacactgatctctcaaaaaaaaaaaa                        c.*2743

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Ganglioside-induced differentiation-associated protein 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 31
©2004-2011 Leiden University Medical Center