optic atrophy 1 (autosomal dominant) (OPA1) - coding DNA reference sequence

(used for mutation description)

(last modified April 8, 2011)


This file was created to facilitate the description of sequence variants in the OPA1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011605.1, covering OPA1 transcript NM_130837.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5054
       gtgctgcccgcctagaaagggtgaagtggttgtttccgtgacggactgagtacg       c.-181

 .         .         .         .         .         .                g.5114
 ggtgcctgtcaggctcttgcggaagtccatgcgccattgggagggcctcggccgcggctc       c.-121

 .         .         .         .         .         .                g.5174
 tgtgcccttgctgctgagggccacttcctgggtcattcctggaccgggagccgggctggg       c.-61

 .         .         .         .         .         .                g.5234
 gctcacacgggggctcccgcgtggccgtctcggcgcctgcgtgacctccccgccggcggg       c.-1

          .         .         .   | 02     .         .         .    g.26607
 ATGTGGCGACTACGTCGGGCCGCTGTGGCCTG | TGAGGTCTGCCAGTCTTTAGTGAAACAC    c.60
 M  W  R  L  R  R  A  A  V  A  C  |  E  V  C  Q  S  L  V  K  H      p.20

          .         .         .         .         .         .       g.26667
 AGCTCTGGAATAAAAGGAAGTTTACCACTACAAAAACTACATCTGGTTTCACGAAGCATT       c.120
 S  S  G  I  K  G  S  L  P  L  Q  K  L  H  L  V  S  R  S  I         p.40

          .         .         .         .         .         .       g.26727
 TATCATTCACATCATCCTACCTTAAAGCTTCAACGACCCCAATTAAGGACATCCTTTCAG       c.180
 Y  H  S  H  H  P  T  L  K  L  Q  R  P  Q  L  R  T  S  F  Q         p.60

          .         .         .         .         .         .       g.26787
 CAGTTCTCTTCTCTGACAAACCTTCCTTTACGTAAACTGAAATTCTCTCCAATTAAATAT       c.240
 Q  F  S  S  L  T  N  L  P  L  R  K  L  K  F  S  P  I  K  Y         p.80

          .         .         .         .         .         .       g.26847
 GGCTACCAGCCTCGCAGGAATTTTTGGCCAGCAAGATTAGCTACGAGACTCTTAAAACTT       c.300
 G  Y  Q  P  R  R  N  F  W  P  A  R  L  A  T  R  L  L  K  L         p.100

          .         .         .         .         .  | 03      .    g.27539
 CGCTATCTCATACTAGGATCGGCTGTTGGGGGTGGCTACACAGCCAAAAAG | ACTTTTGAT    c.360
 R  Y  L  I  L  G  S  A  V  G  G  G  Y  T  A  K  K   | T  F  D      p.120

          .         .         .         .         .         .       g.27599
 CAGTGGAAAGATATGATACCGGACCTTAGTGAATATAAATGGATTGTGCCTGACATTGTG       c.420
 Q  W  K  D  M  I  P  D  L  S  E  Y  K  W  I  V  P  D  I  V         p.140

          .         .         | 04         .         .         .    g.29066
 TGGGAAATTGATGAGTATATCGATTTTG | AGAAAATTAGAAAAGCCCTTCCTAGTTCAGAA    c.480
 W  E  I  D  E  Y  I  D  F  E |   K  I  R  K  A  L  P  S  S  E      p.160

          .         .         .         .         .         .       g.29126
 GACCTTGTAAAGTTAGCACCAGACTTTGACAAGATTGTTGAAAGCCTTAGCTTATTGAAG       c.540
 D  L  V  K  L  A  P  D  F  D  K  I  V  E  S  L  S  L  L  K         p.180

          .       | 05 .         .         .         .         .    g.29684
 GACTTTTTTACCTCAG | GTCACAAATTGGTTAGTGAAGTCATAGGAGCTTCTGACCTACTT    c.600
 D  F  F  T  S  G |   H  K  L  V  S  E  V  I  G  A  S  D  L  L      p.200

          . | 06       .         .         .         .         .    g.30775
 CTCTTGTTAG | GTTCTCCGGAAGAAACGGCGTTTAGAGCAACAGATCGTGGATCTGAAAGT    c.660
 L  L  L  G |   S  P  E  E  T  A  F  R  A  T  D  R  G  S  E  S      p.220

          .         | 07         .         .         .         .    g.37990
 GACAAGCATTTTAGAAAG | GGTCTGCTTGGTGAGCTCATTCTCTTACAACAACAAATTCAA    c.720
 D  K  H  F  R  K   | G  L  L  G  E  L  I  L  L  Q  Q  Q  I  Q      p.240

          .         .         .         .         .         .       g.38050
 GAGCATGAAGAGGAAGCGCGCAGAGCCGCTGGCCAATATAGCACGAGCTATGCCCAACAG       c.780
 E  H  E  E  E  A  R  R  A  A  G  Q  Y  S  T  S  Y  A  Q  Q         p.260

           | 08        .         .         .         .         .    g.43519
 AAGCGCAAG | GTGTCAGACAAAGAGAAAATTGACCAACTTCAGGAAGAACTTCTGCACACT    c.840
 K  R  K   | V  S  D  K  E  K  I  D  Q  L  Q  E  E  L  L  H  T      p.280

     | 09    .         .         .         .         .         .    g.47331
 CAG | TTGAAGTATCAGAGAATCTTGGAACGATTAGAAAAGGAGAACAAAGAATTGAGAAAA    c.900
 Q   | L  K  Y  Q  R  I  L  E  R  L  E  K  E  N  K  E  L  R  K      p.300

          .         .         .         .         | 10         .    g.49063
 TTAGTATTGCAGAAAGATGACAAAGGCATTCATCATAGAAAGCTTAAG | AAATCTTTGATT    c.960
 L  V  L  Q  K  D  D  K  G  I  H  H  R  K  L  K   | K  S  L  I      p.320

          .         .         .         .         .         .       g.49123
 GACATGTATTCTGAAGTTCTTGATGTTCTCTCTGATTATGATGCCAGTTATAATACGCAA       c.1020
 D  M  Y  S  E  V  L  D  V  L  S  D  Y  D  A  S  Y  N  T  Q         p.340

          .      | 11  .         .         .         .         .    g.49853
 GATCATCTGCCACGG | GTTGTTGTGGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTG    c.1080
 D  H  L  P  R   | V  V  V  V  G  D  Q  S  A  G  K  T  S  V  L      p.360

          .         .         .         .         .         .       g.49913
 GAAATGATTGCCCAAGCTCGAATATTCCCAAGAGGATCTGGGGAGATGATGACACGTTCT       c.1140
 E  M  I  A  Q  A  R  I  F  P  R  G  S  G  E  M  M  T  R  S         p.380

           | 12        .         .         .         .         .    g.54672
 CCAGTTAAG | GTGACTCTGAGTGAAGGTCCTCACCATGTGGCCCTATTTAAAGATAGTTCT    c.1200
 P  V  K   | V  T  L  S  E  G  P  H  H  V  A  L  F  K  D  S  S      p.400

          .         .         . | 13       .         .         .    g.54861
 CGGGAGTTTGATCTTACCAAAGAAGAAGAT | CTTGCAGCATTAAGACATGAAATAGAACTT    c.1260
 R  E  F  D  L  T  K  E  E  D   | L  A  A  L  R  H  E  I  E  L      p.420

          .         .         .         .      | 14  .         .    g.55244
 CGAATGAGGAAAAATGTGAAAGAAGGCTGTACCGTTAGCCCTGAG | ACCATATCCTTAAAT    c.1320
 R  M  R  K  N  V  K  E  G  C  T  V  S  P  E   | T  I  S  L  N      p.440

          .         .         .         .         .        | 15.    g.55387
 GTAAAAGGCCCTGGACTACAGAGGATGGTGCTTGTTGACTTACCAGGTGTGATTAAT | ACT    c.1380
 V  K  G  P  G  L  Q  R  M  V  L  V  D  L  P  G  V  I  N   | T      p.460

          .         .         .         .         .         .       g.55447
 GTGACATCAGGCATGGCTCCTGACACAAAGGAAACTATTTTCAGTATCAGCAAAGCTTAC       c.1440
 V  T  S  G  M  A  P  D  T  K  E  T  I  F  S  I  S  K  A  Y         p.480

          .         .         .        | 16.         .         .    g.55854
 ATGCAGAATCCTAATGCCATCATACTGTGTATTCAAG | ATGGATCTGTGGATGCTGAACGC    c.1500
 M  Q  N  P  N  A  I  I  L  C  I  Q  D |   G  S  V  D  A  E  R      p.500

          .         .         .         .         .         .       g.55914
 AGTATTGTTACAGACTTGGTCAGTCAAATGGACCCTCATGGAAGGAGAACCATATTCGTT       c.1560
 S  I  V  T  D  L  V  S  Q  M  D  P  H  G  R  R  T  I  F  V         p.520

          .         .         .         .         | 17         .    g.57421
 TTGACCAAAGTAGACCTGGCAGAGAAAAATGTAGCCAGTCCAAGCAGG | ATTCAGCAGATA    c.1620
 L  T  K  V  D  L  A  E  K  N  V  A  S  P  S  R   | I  Q  Q  I      p.540

          .         .         .         .         .         .       g.57481
 ATTGAAGGAAAGCTCTTCCCAATGAAAGCTTTAGGTTATTTTGCTGTTGTAACAGGAAAA       c.1680
 I  E  G  K  L  F  P  M  K  A  L  G  Y  F  A  V  V  T  G  K         p.560

   | 18      .         .         .         .         .         .    g.57643
 G | GGAACAGCTCTGAAAGCATTGAAGCTATAAGAGAATATGAAGAAGAGTTTTTTCAGAAT    c.1740
 G |   N  S  S  E  S  I  E  A  I  R  E  Y  E  E  E  F  F  Q  N      p.580

          .     | 19   .         .         .         .         .    g.58967
 TCAAAGCTCCTAAA | GACAAGCATGCTAAAGGCACACCAAGTGACTACAAGAAATTTAAGC    c.1800
 S  K  L  L  K  |  T  S  M  L  K  A  H  Q  V  T  T  R  N  L  S      p.600

          .         .         .         .         .         .       g.59027
 CTTGCAGTATCAGACTGCTTTTGGAAAATGGTACGAGAGTCTGTTGAACAACAGGCTGAT       c.1860
 L  A  V  S  D  C  F  W  K  M  V  R  E  S  V  E  Q  Q  A  D         p.620

          . | 20       .         .         .         .         .    g.59976
 AGTTTCAAAG | CAACACGTTTTAACCTTGAAACTGAATGGAAGAATAACTATCCTCGCCTG    c.1920
 S  F  K  A |   T  R  F  N  L  E  T  E  W  K  N  N  Y  P  R  L      p.640

          .      | 21  .         .         .         .         .    g.60696
 CGGGAACTTGACCGG | AATGAACTATTTGAAAAAGCTAAAAATGAAATCCTTGATGAAGTT    c.1980
 R  E  L  D  R   | N  E  L  F  E  K  A  K  N  E  I  L  D  E  V      p.660

          .         .         .   | 22     .         .         .    g.66746
 ATCAGTCTGAGCCAGGTTACACCAAAACATTG | GGAGGAAATCCTTCAACAATCTTTGTGG    c.2040
 I  S  L  S  Q  V  T  P  K  H  W  |  E  E  I  L  Q  Q  S  L  W      p.680

          .         .         .         .         .         .       g.66806
 GAAAGAGTATCAACTCATGTGATTGAAAACATCTACCTTCCAGCTGCGCAGACCATGAAT       c.2100
 E  R  V  S  T  H  V  I  E  N  I  Y  L  P  A  A  Q  T  M  N         p.700

          .         .         .         .         .         .       g.66866
 TCAGGAACTTTTAACACCACAGTGGATATCAAGCTTAAACAGTGGACTGATAAACAACTT       c.2160
 S  G  T  F  N  T  T  V  D  I  K  L  K  Q  W  T  D  K  Q  L         p.720

          .         | 23         .         .         .         .    g.68978
 CCTAATAAAGCAGTAGAG | GTTGCTTGGGAGACCCTACAAGAAGAATTTTCCCGCTTTATG    c.2220
 P  N  K  A  V  E   | V  A  W  E  T  L  Q  E  E  F  S  R  F  M      p.740

          .         .         .         .         .         .       g.69038
 ACAGAACCGAAAGGGAAAGAGCATGATGACATATTTGATAAACTTAAAGAGGCTGTTAAG       c.2280
 T  E  P  K  G  K  E  H  D  D  I  F  D  K  L  K  E  A  V  K         p.760

          .         .         .         .         .  | 24      .    g.70752
 GAAGAAAGTATTAAACGACACAAGTGGAATGACTTTGCGGAGGACAGCTTG | AGGGTTATT    c.2340
 E  E  S  I  K  R  H  K  W  N  D  F  A  E  D  S  L   | R  V  I      p.780

          .         .         .         .         .         .       g.70812
 CAACACAATGCTTTGGAAGACCGATCCATATCTGATAAACAGCAATGGGATGCAGCTATT       c.2400
 Q  H  N  A  L  E  D  R  S  I  S  D  K  Q  Q  W  D  A  A  I         p.800

          .         .         .         . | 25       .         .    g.71358
 TATTTTATGGAAGAGGCTCTGCAGGCTCGTCTCAAGGATA | CTGAAAATGCAATTGAAAAC    c.2460
 Y  F  M  E  E  A  L  Q  A  R  L  K  D  T |   E  N  A  I  E  N      p.820

          .         .         .         .         .         .       g.71418
 ATGGTGGGTCCAGACTGGAAAAAGAGGTGGTTATACTGGAAGAATCGGACCCAAGAACAG       c.2520
 M  V  G  P  D  W  K  K  R  W  L  Y  W  K  N  R  T  Q  E  Q         p.840

  | 26       .         .         .         .         .         .    g.74738
  | TGTGTTCACAATGAAACCAAGAATGAATTGGAGAAGATGTTGAAATGTAATGAGGAGCAC    c.2580
  | C  V  H  N  E  T  K  N  E  L  E  K  M  L  K  C  N  E  E  H      p.860

          .         .         .         .         .         .       g.74798
 CCAGCTTATCTTGCAAGTGATGAAATAACCACAGTCCGGAAGAACCTTGAATCCCGAGGA       c.2640
 P  A  Y  L  A  S  D  E  I  T  T  V  R  K  N  L  E  S  R  G         p.880

          .         .  | 27      .         .         .         .    g.76775
 GTAGAAGTAGATCCAAGCTTG | ATTAAGGATACTTGGCATCAAGTTTATAGAAGACATTTT    c.2700
 V  E  V  D  P  S  L   | I  K  D  T  W  H  Q  V  Y  R  R  H  F      p.900

          .         .         .         .         .         .       g.76835
 TTAAAAACAGCTCTAAACCATTGTAACCTTTGTCGAAGAGGTTTTTATTACTACCAAAGG       c.2760
 L  K  T  A  L  N  H  C  N  L  C  R  R  G  F  Y  Y  Y  Q  R         p.920

          .         | 28         .         .         .         .    g.78194
 CATTTTGTAGATTCTGAG | TTGGAATGCAATGATGTGGTCTTGTTTTGGCGTATACAGCGC    c.2820
 H  F  V  D  S  E   | L  E  C  N  D  V  V  L  F  W  R  I  Q  R      p.940

          .         .         .         .         .   | 29     .    g.79034
 ATGCTTGCTATCACCGCAAATACTTTAAGGCAACAACTTACAAATACTGAAG | TTAGGCGA    c.2880
 M  L  A  I  T  A  N  T  L  R  Q  Q  L  T  N  T  E  V |   R  R      p.960

          .         .         .         .         .         .       g.79094
 TTAGAGAAAAATGTTAAAGAGGTATTGGAAGATTTTGCTGAAGATGGTGAGAAGAAGATT       c.2940
 L  E  K  N  V  K  E  V  L  E  D  F  A  E  D  G  E  K  K  I         p.980

          .         .         .         .    | 30    .         .    g.103936
 AAATTGCTTACTGGTAAACGCGTTCAACTGGCGGAAGACCTCA | AGAAAGTTAGAGAAATT    c.3000
 K  L  L  T  G  K  R  V  Q  L  A  E  D  L  K |   K  V  R  E  I      p.1000

          .         .         .         .                       g.103984
 CAAGAAAAACTTGATGCTTTCATTGAAGCTCTTCATCAGGAGAAATAA |                c.3049
 Q  E  K  L  D  A  F  I  E  A  L  H  Q  E  K  X                  p.1015

       | 31  .         .         .         .         .         .    g.106517
 attaa | aatcgtactcataatcagctctgcatacatctgaagaacaaaaacatcaacgtct    c.*60

          .         .         .         .         .         .       g.106577
 tttgtccagcctctttttcttctgctgttccacctttctaaacatacaataaagtcatgg       c.*120

          .         .         .         .         .         .       g.106637
 gataaaaataatcgatgtatgttacgggcgctttaaccatcagctgcctctcgaatggaa       c.*180

          .         .         .         .         .         .       g.106697
 gaacagtggtaatggattaacatcctattttgttgtactaaagtgacaaatcggaataat       c.*240

          .         .         .         .         .         .       g.106757
 ataattggtatggccattaggttcagtccttgaagataagaaacttgttctctgtttgtt       c.*300

          .         .         .         .         .         .       g.106817
 gtcttatttgtggtggcactcgtttaatggattaactgaggttgctcaatgttcagtttc       c.*360

          .         .         .         .         .         .       g.106877
 ttttccagaaatacaatgctaggtgttttgaaataaaacttatatagcaattgtttaaag       c.*420

          .         .         .         .         .         .       g.106937
 ttatcaattgtatataaaatcacagtagcctgctaaatcattgtatgtgtctgtagtatt       c.*480

          .         .         .         .         .         .       g.106997
 ctattcccagaaactatttgaccatgataattcagtttatattcaccacatgaaagaaaa       c.*540

          .         .         .         .         .         .       g.107057
 atgggtaacagaagaacccttaaaacaggttaatttggattgtaacgttcagtgaaagaa       c.*600

          .         .         .         .         .         .       g.107117
 atttcaacccttcatagccagcgaagaaatttgccttggaagccaagtcagtaccagctt       c.*660

          .         .         .         .         .         .       g.107177
 acctatttgattcagttgctgttttctcactctctatatccatttgaaattgatttattt       c.*720

          .         .         .         .         .         .       g.107237
 tagatgttgtatacttacgttaggctttctgttaatagtggtttttctcctgttgacaga       c.*780

          .         .         .         .         .         .       g.107297
 gccaccggattatgacacaggatgaggaagattaaggataatcaattgactaatttcatt       c.*840

          .         .         .         .         .         .       g.107357
 tagaatattatcaaacatttcaactaggtatcagaaaaaggctttctttcataagactat       c.*900

          .         .         .         .         .         .       g.107417
 tttaaatagaaattatttcaacaattaaagtaatgttgaccatccccctctcagctgaat       c.*960

          .         .         .         .         .         .       g.107477
 aaagaaaaatttagttcaatttattgcaatttaattacaatactaccttcacaacatttt       c.*1020

          .         .         .         .         .         .       g.107537
 catgtgttttaaataaatattttttaattggctaaaggacattcaagcaaagaaatgctt       c.*1080

          .         .         .         .         .         .       g.107597
 tctttacttaaaatgtctatctcatttgctgccttttcactaagcctttactttgttaat       c.*1140

          .         .         .         .         .         .       g.107657
 aaaagtgtccattgtgtgatgtttttgattttacagtttgctaaatcttattttcttgga       c.*1200

          .         .         .         .         .         .       g.107717
 gttgctttttggtaacagccccattgctactccccattttattgttttacatcaatgcat       c.*1260

          .         .         .         .         .         .       g.107777
 gcttcgttgtgatccctcaagatgtaacacttggtatgctcggttgaggatatgaaaaaa       c.*1320

          .         .         .         .         .         .       g.107837
 tacttccgaaaccaggaattcaatgtatgtttgttttatactgtttgataagaaaagtag       c.*1380

          .         .         .         .         .         .       g.107897
 gtccagccttaagcagcacagatgcgctggtagatgcatagtcaggaactttttttattt       c.*1440

          .         .         .         .         .         .       g.107957
 cttttaggtctagggacaggagtgaatagaaagggaggagagctctattatgttctatac       c.*1500

          .         .         .         .         .         .       g.108017
 acagattaggagatgaccttactgggtacacccctctaaccagtgcttacaggttaatgc       c.*1560

          .         .         .         .         .         .       g.108077
 atgttaatgaatatttttgcagttgtaaagcataacaattacaactacacatctatttct       c.*1620

          .         .         .         .         .         .       g.108137
 aaagaataaaacaggaccatatttatttacttctgtcaactatagaaagaaagaccttca       c.*1680

          .         .         .         .         .         .       g.108197
 gctgtatttccacagatttctcccaaggaaaaggctaatattagtcactactgttatcac       c.*1740

          .         .         .         .         .         .       g.108257
 atccctttgtataagttttaaaaagagatggagggagatcttcatttctttgaggagatc       c.*1800

          .         .         .         .         .         .       g.108317
 agtattgtaacgtatgtgaatagatgataacaattaatattactaaaagtcccacatgag       c.*1860

          .         .         .         .         .         .       g.108377
 agtcctgacgccctctccatgccccacagtaatgtggcttctttcatgggtttttttttc       c.*1920

          .         .         .         .         .         .       g.108437
 ttctttttagctgatctcatcctaagcatgctttatttttccttgaaagctaggtattta       c.*1980

          .         .         .         .         .         .       g.108497
 tcaactgcagatgttattgaaagaaaataaaattcagtctcaagagtaaaccctgtgtct       c.*2040

          .         .         .         .         .         .       g.108557
 tgtgtctgtagttcaaaagtcagaaatgattctaatttaaacaaaaagatactaaatata       c.*2100

          .         .         .         .         .         .       g.108617
 cagaagttaaattcgaactagccacagaatcatttgtttttatgtcagaatttgcaaaga       c.*2160

          .         .         .         .         .         .       g.108677
 gtggagtggacaaagctctgtatggaagactgaacaactgtaaatagatgatatccaaac       c.*2220

          .         .         .         .         .         .       g.108737
 ttaatttggctaggacttcaattttaaaaatcagtgtacctaggcagtgcacagcacgaa       c.*2280

          .         .         .         .         .         .       g.108797
 ataagtggcccttgcagcttccccgtttaacccactgtgctatagttgcgggtggaacag       c.*2340

          .         .         .         .         .         .       g.108857
 tcaacctttctagtagtttatgatattgccctctttgtattcccattttctacagttttt       c.*2400

          .         .         .         .         .         .       g.108917
 tccgcagacttctttctgcaaattattcagcctccaaatgcaaatgaatgatataaaaat       c.*2460

          .         .         .         .         .         .       g.108977
 aagtagggaacatggcagagagtggtgcttcccagcctcacaatgtgggaatttgacata       c.*2520

          .         .         .         .         .         .       g.109037
 ggatgagagtcagagtataggtttaaaagataaaatctttagttaataattttgtattta       c.*2580

          .         .         .         .         .         .       g.109097
 tttattctagatgtatgtatctgaggaaagaaatctggtatttttgctttccaataaagg       c.*2640

          .         .         .         .         .         .       g.109157
 ggatcaaagtaatggtttttctctcagttctctaagctggtctatgttatagctctagca       c.*2700

          .         .         .         .         .         .       g.109217
 gtatggaaatgtgctttaaaatatgcttaccttttgaatgatcatggctatatgttgttg       c.*2760

          .         .         .         .         .         .       g.109277
 agatatttgaaacttaccttgttttcacttgtgcactgtgaatgaactttgtattatttt       c.*2820

          .         .         .         .         .         .       g.109337
 tttaaaaccttcacattacgtgtagatattattgcaacttatattttgcctgagcttgat       c.*2880

          .         .         .         .         .         .       g.109397
 caaaggtcatttgtgtagatgagtaattaaaaaatatttaaatcacattataattctatt       c.*2940

          .         .         .         .         .         .       g.109457
 attggagagcatcttttaaatttttttctgttttaacgagggaaagagaaacctgtatac       c.*3000

          .         .         .         .         .         .       g.109517
 ctagggtcattatttgaccccatagtataaccagattcatggtctaacaagctctcagtg       c.*3060

          .         .         .         .         .         .       g.109577
 tggcttttctctgaatgcttgaatttcacatgccttgcatttcacagttgtactccatgg       c.*3120

          .         .         .         .         .         .       g.109637
 tcaaccggtgctttttttcacatcgtggtacttgtcaaaacattttgttattttccttgg       c.*3180

          .         .         .                                     g.109668
 taaaatatataaaaaaggttttctaatttca                                    c.*3211

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Optic atrophy 1 (autosomal dominant) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 31
©2004-2011 Leiden University Medical Center